“Meaty, well-written.” —Kirkus Reviews “Timely and informative.” —The New York Times Book Review “By far the best book I have ever read on humanity’s deep history.” —E. O. Wilson, biologist and author of The Ants and On Human Nature Nicholas Wade’s articles are a major reason why the science section has become the most popular, nationwide, in the New York Times. In his groundbreaking Before the Dawn, Wade reveals humanity’s origins as never before—a journey made possible only recently by genetic science, whose incredible findings have answered such questions as: What was the first human language like? How large were the first societies, and how warlike were they? When did our ancestors first leave Africa, and by what route did they leave? By eloquently solving these and numerous other mysteries, Wade offers nothing less than a uniquely complete retelling of a story that began 500 centuries ago.

Noted science writer Nicholas Wade offers for the first time a convincing case based on a broad range of scientific evidence for the evolutionary basis of religion.

Drawing on startling new evidence from the mapping of the genome, an explosive new account of the genetic basis of race and its role in the human story Fewer ideas have been more toxic or harmful than the idea of the biological reality of race, and with it the idea that humans of different races are biologically different from one another. For this understandable reason, the idea has been banished from polite academic conversation. Arguing that race is more than just a social construct can get a scholar run out of town, or at least off campus, on a rail. Human evolution, the consensus view insists, ended in prehistory. Inconveniently, as Nicholas Wade argues in A Troublesome Inheritance, the consensus view cannot be right. And in fact, we know that populations have changed in the past few thousand years—to be lactose tolerant, for example, and to survive at high altitudes. Race is not a bright-line distinction; by definition it means that the more human populations are kept apart, the more they evolve their own distinct traits under the selective pressure known as Darwinian evolution. For many thousands of years, most human populations stayed where they were and grew distinct, not just in outward appearance but in deeper senses as well. Wade, the longtime journalist covering genetic advances for The New York Times, draws widely on the work of scientists who have made crucial breakthroughs in establishing the reality of recent human evolution. The most provocative claims in this book involve the genetic basis of human social habits. What we might call middle-class social traits—thrift, docility, nonviolence—have been slowly but surely inculcated genetically within agrarian societies, Wade argues. These “values” obviously had a strong cultural component, but Wade points to evidence that agrarian societies evolved away from hunter-gatherer societies in some crucial respects. Also controversial are his findings regarding the genetic basis of traits we associate with intelligence, such as literacy and numeracy, in certain ethnic populations, including the Chinese and Ashkenazi Jews. Wade believes deeply in the fundamental equality of all human peoples. He also believes that science is best served by pursuing the truth without fear, and if his mission to arrive at a coherent summa of what the new genetic science does and does not tell us about race and human history leads straight into a minefield, then so be it. This will not be the last word on the subject, but it will begin a powerful and overdue conversation.

Did the Covid virus jump naturally from an animal species to humans, or did it escape from a laboratory experiment? In this essay, science writer Nicholas Wade explores the two scenarios and argues that, on present evidence, lab escape is the more likely explanation. His inference is based on specific research being conducted at the Wuhan Institute of Virology and the Institute’s lack of adequate safety precautions, together with the continuing absence of any direct evidence to support natural emergence. The essay discusses the failure of the mainstream media to penetrate the self-interested assurance of virologists that lab escape was a dismissible conspiracy theory. It also notes how the politicization of discussion impeded consideration of the scientific facts.

Cro-Magnons were the first fully modern Europeans--not only the creators of the stunning cave paintings at Lascaux and elsewhere, but the most adaptable and technologically inventive people that had yet lived on earth. The prolonged encounter between theCro-Magnons and the archaic Neanderthals, between 45,000 and 30,000 years ago, was one of the defining moments of history. The Neanderthals survived for some 15,000 years in the face of the newcomers, but were finally pushed aside by the Cro-Magnons' vastly superior intellectual abilities and cutting-edge technologies. What do we know about this remarkable takeover? Who were these first modern Europeans and what were they like? How did they manage to thrive in such an extreme environment? And what legacydid they leave behind them after the cold millennia? This is the story of a little known, yet seminal, chapter of human experience.--From publisher description.

This breakthrough book brings science into history to offer a dazzling new vision of humanity across time. Team-written by leading experts in a variety of fields, it maps events, cultures, and eras across millions of years to present a new scale for understanding the human body, energy and ecosystems, language, food, kinship, migration, and more.

'You will not find a better, more balanced or up-to-date take on either the origin of life or synthetic biology. Essential reading' Observer Creation by Adam Rutherford tells the entire spellbinding story of life in two gripping narratives. 'Prepare to be astounded. There are moments when this book is so gripping it reads like a thriller' Mail on Sunday The Origin of Life is a four-billion-year detective story that uses the latest science to explain what life is and where it first came from, dealing with life's biggest questions and arriving at a thrilling answer. 'A superbly written explanation' Brian Cox The Future of Life introduces an extraordinary technological revolution: 'synthetic biology', the ability to create entirely new life forms within the lab. Adam Rutherford explains how this remarkable innovation works and presents a powerful argument for its benefit to humankind. 'The reader's sense of awe at the well-nigh inconceivable nature of nature is suitably awakened. The extraordinary science and Rutherford's argument are worth every reader's scrutiny. Fascinating' Sunday Telegraph 'One of the most eloquent and genuinely thoughtful books on science over the past decade. You will not find a better, more balanced or up-to-date take on the origin of life or synthetic biology. Essential reading for anyone interested in the coming revolution, which could indeed rival the Industrial Revolution or the internet' Observer 'The perfect primer on the past and future of DNA' Guardian 'Susenseful, erudite and thrilling' Prospect 'A witty, engaging and eye-opening explanation of the basic units of life, right back to our common ancestors and on to their incredible synthetic future. The mark of a really good science book, it shows that the questions we still have are just as exciting as the answers we already know' Dara O Briain 'This is a quite delightful two-books-in-one. Rutherford's lightness of touch in describing the dizzying complexity of life at the cellular level in The Origin of Life only serves to emphasise the sheer scale and ambition of the emerging field of synthetic biology' Jim Al Khalili 'A fascinating glimpse into our past and future. Rutherford's illuminating book is full of optimism about what we might be able to achieve' Sunday Times 'Fresh, original and excellent. An eye-opening look at how we are modifying and constructing life. Totally fascinating' PopularScience.co.uk 'In this book of two halves, Rutherford tells the epic history of life on earth, and eloquently argues the case for embracing technology which allows us to become biological designers' Alice Roberts 'An engaging account of both the mystery of life's origin and its impending resolution as well as a fascinating glimpse of the impending birth of a new, synthetic biology'' Matt Ridley, author of Genome 'I warmly recommend Creation. Rutherford's academic background in genetics gives him a firm grasp of the intricacies of biochemistry - and he translates these superbly into clear English' Financial Times Dr Adam Rutherford is a geneticist, writer and broadcaster. He presents BBC Radio 4's weekly programme Inside Science and his documentaries include the award-winning series The Cell (BBC4), The Gene Code (BBC4), Horizon: 'Playing God' (BBC2) as well as numerous other programmes for BBC Radio 4. This is his first book. TGTCGTGAAGCTACTATTTAAAATGCCACAGTGAAAGATTAAACGCCCGAAAACGGGGTGATAAATGGACGGTAAGTTCCCGACTAAACGTGTTAAATG